Business Ownership Choices †10 Mark Question Essay

Orion Designs was established five year ago by Amita Patel and her friend, Yi Ling, after they both finished Art and Design courses. Orion Designs is run as a partnership between the two women. There are currently no other partners. Amita and Yi create hand drawn designs in their studio which is located on an industrial estate. These designs are then sent to another business where a computer is used to put the designs onto transfers. When Amita and Yi get these transfers back, they are put onto mugs and plates purchased from a separate pottery company. Orion Designs then sells the finished mugs and plates as souvenirs. Orion Designs has been making increased profits each year. Amita and Yi now want to expand the business. They could increase the range of items onto which they put the transfers (eg. Mousemats), or perform all of the production processes at Orion Designs. Amita and Yi are aware of the risks involved in expanding the business. Even though they have already invested their own money in the business, there may be a need for additional finance as well as more employees. Actual Question: Amita and Yi have recently had a meeting with a local business advisor about their plan for the expansion of Orion Designs. They were given three possible options: * Option 1- stay as they are; * Option 2- take on additional partners * Option 3 – turn the business into a private limited company. Recommend the best option for Amita and Yi, explaining why the other options were not chosen. Introduction: Amita and Yi are two friends who have a business that puts designs onto pottery. They are currently a partnership but are trying to work out whether they should change the ownership type of their business in order to expand. Paragraph 1 (Analysis of Option 1 and Option 2) The business is currently a partnership so Amita and Yi both have unlimited liability. This means they would have to sell their personal assets if the business went into debt. If they took option 1 this disadvantage would still remain. Option 1 is low risk as they are not doing anything different but it might be difficult for them to expand as they won’t have any additional finance. If they know people who want to join their business then they could take on additional partners, these would have unlimited liability as well. This would bring money into the business but these new partners might want a say in running the business and it might not be what Amita and Yi want, this could lead to arguments. Paragraph 2 (Analysis of Option 3) As a private limited company, the owners of Orion Designs have the benefits of limited liability so they can only lose the amount of money that they invested in the company. So the owners of the business would have more security. If Orion Designs want to expand and have new ranges then they will need more money, if they become ltd they could raise the money they need by having shareholders. This would be an advantage to Orion Designs. At the moment all profits go to Amita and Yi, if they were to become a private limited company they would receive less profits themselves as they would have to pay dividends to all shareholders. Conclusion At the moment there are only two partners, Amita and Yi so they will be limited in the amount of money they can invest but they can make all the decisions themselves. If it were to become a ltd then other shareholders would be able to make decisions and Amita and Yi would lose some control of their business. There are also legal formalities involves in becoming a ltd which would take time and cost money. In order to secure the future of the business and expand I recommend that Orion Designs takes option 2 and stays as a partnership but invites other partners to invest in the business. This way they get the advantage of more capital in the business but do not have to spend a lot of time and money becoming an ltd.

Doctrine of Repugnance

From time immemorial, legislative bodies have been enacting laws all over the world. With the enactment of laws by different legislative bodies all over the world, conflict of laws is an unavoidable issue. However, in this article I will mainly be focusing on the conflict of laws with regard to India. In India, there are three wings of the Government, namely, The Legislature, The Judiciary and the Executive. The legislature has the law making powers for the entire country. The legislature is further divided into the Centre and the State. Doctrine of Repugnancy deals with the conflict of laws between the State and the Centre. Part XI of the Indian Constitution describes the legislative relations between the States and the Centre. The legislative field of the Parliament and the State Legislatures has been specified in Article 246 of the Constitution whereas Article 254 of the Indian Constitution describes the mechanism for resolution of conflict between the Central and the State legislations enacted with respect to any matter enumerated in List III of the Seventh Schedule. Various judicial pronouncements have declared the pre-conditions for the application of the doctrine of repugnancy. In the case of M. Karunanidhi v. Union of India, the Constitutional Bench laid down the tests for the application of the Doctrine of Repugnancy, which is as follows: â€Å"1. That in order to decide the question of repugnancy it must be shown that the two enactments contain inconsistent and irreconcilable provisions, so that they cannot stand together or operate in the same field. 2. That there can be no repeal by implication unless the inconsistency appears on the face of the two statutes. . That where the two statutes occupy a particular field, but there is room or possibility of both the statutes operating in the same field without coming into collision with each other, no repugnancy results. 4. That where there is no inconsistency but a statute occupying the same field seeks to create distinct and separate offences, no question of repugnancy arises and both the statutes continue to operate in the same field. † In National Engineering Industries Ltd. Vs. Shri Kishan, the Supreme Court observed : In order that a question of repugnancy may be arise, two conditions must be fulfilled, namely that the State Law and the Laws of the Union must operate the name field and one must be repugnant or inconsistent with the other. † From the plain reading of the Articles 246 and 254 it is clear that in case of a conflict between the Union laws and State laws, it is the Union law which shall prevail if it is made within an entry of List III of the Constitution. In such a scenario if any provision of a State-made law is in conflict with the Parliament–made law under such circumstance the State-made law is declared void to the extent of repugnancy. However, this general rule is subject to Clause (2) of Article 254 of the Indian Constitution. The Clause (2) of the said Article says that that the State law will become void to the extent of repugnancy unless the State law has been reserved for the assent of the President. If the Preseident grants his assent to the said state law, then the Union law, to the extent of its repugnancy will become void in that state. However, this does not curtail the power of the Parliament from enacting at any time any law with respect to the same matter including a Law adding to amending varying or repealing the law so made by the legislature of the State. Thus, what is visible to us by analyzing the various judicial pronouncements and by going through the Constitution is that both the Centre and the State have supreme powers with regard to enacting the laws for their respective domains but in the presence of a conflict, it is the Centre-made laws which shall prevail in most cases. The Supreme Court in Zameer Ahmed Latifur Rehman Sheikh Vs. State of Maharashtra has examined the law relating to the Doctrine of Repugnancy. In essence, Part XI of the Indian Constitution describes the legislative relations between the States and the Centre. Further, Article 254 establishes the doctrine of Repugnancy which acts as a safeguard to solve disputes arising between the states and the Union. The term ‘Repugnancy’ means inconsistency between the State-made law and the Union-made law. The relevant extracts from the judgment are reproduced hereunder; 46. Before we proceed to analyze the said aspect, it would be appropriate to understand the situations in which repugnancy would arise. 47. Chapter I of Part XI of the Constitution deals with the subject of distribution of legislative powers of the Parliament and the legislature of the States. Article 245 of the Constitution provides that the Parliament may make laws for the whole or any part of the territory of India, and the legislature of a State may make laws for the whole or any part of the State. 48. The legislative field of the Parliament and the State Legislatures has been specified in Article 246 of the Constitution. Article 246, reads as follows: – 49. We may now refer to the judgment of this Court in M. Karunanidhi v. Union of India, [(1979) 3 SCC 431], which is one of the most authoritative judgments on the present issue. In the said case, the principles to be applied for determining repugnancy between a law made by the Parliament and a law made by the State Legislature were considered by a Constitution Bench of this Court. At para 8, this Court held that repugnancy may result from the following circumstances: â€Å"1. Where the provisions of a Central Act and a State Act in the Concurrent List are fully inconsistent and are absolutely irreconcilable, the Central Act will prevail and the State Act will become void in view of the repugnancy. Where however a law passed by the State comes into collision with a law passed by Parliament on an Entry in the Concurrent List, the State Act shall prevail to the extent of the repugnancy and the provisions of the Central Act would become void provided the State Act has been passed in accordance with clause (2) of Article 254. 3. Where a law passed by the State Legislature while being substantially within the scope of the entries in the State List entrenches upon any of the Entries in he Central List the constitutionality of the law may be upheld by invoking the doctrine of pith and substance if on an analysis of the provisions of the Act it appears that by and large the law falls within the four corners of the State List and entrenchment, if any, is purely incidental or inconsequential. 4. Where, however, a law made by the State Legislature on a subject covered by the Concurrent List is inconsistent with and repugnant to a previous law made by Parliament, then such a law can be pro tected by obtaining the assent of the President under Article 254(2) of the Constitution. The result of obtaining the assent of the President would be that so far as the State Act is concerned, it will prevail in the State and overrule the provisions of the Central Act in their applicability to the State only. Such a state of affairs will exist only until Parliament may at any time make a law adding to, or amending, varying or repealing the law made by the State Legislature under the proviso to Article 254. † In para 24, this Court further laid down the conditions which must be satisfied before any repugnancy could arise, the said conditions are as follows:- â€Å"1. That there is a clear and direct inconsistency between the Central Act and the State Act. 2. That such an inconsistency is absolutely irreconcilable. 3. That the inconsistency between the provisions of the two Acts is of such nature as to bring the two Acts into direct collision with each other and a situation is reached where it is impossible to obey the one without disobeying the other. † Thereafter, this Court after referring to the catena of judgments on the subject, in para 38, laid down following propositions:- 1. That in order to decide the question of repugnancy it must be shown that the two enactments contain inconsistent and irreconcilable provisions, so that they cannot stand together or operate in the same field. 2. That there can be no repeal by implication unless the inconsistency appears on the face of the two statutes. 3. That where the two statutes occupy a particular field, but there is room or possibility of both the statutes operating in the same field without coming into collision with each other, no repugnancy results. 4. That where there is no inconsistency but a statute occupying the same field seeks to create distinct and separate offences, no question of repugnancy arises and both the statutes continue to operate in the same field. † 50. In Govt. of A. P. v. J. B. Educational Society, [(2005) 3 SCC 212], this Court while discussing the scope of Articles 246 and 254 and considering the proposition laid down by this Court in M. Karunanidhi case (supra) with respect to the situations in which repugnancy would arise, in para 9, held as follows:- â€Å"9. Parliament has exclusive power to legislate with respect to any of the matters enumerated in List I, notwithstanding anything contained in clauses (2) and (3) of Article 246. The non obstante clause under Article 246(1) indicates the predominance or supremacy of the law made by the Union Legislature in the event of an overlap of the law made by Parliament with respect to a matter enumerated in List I and a law made by the State Legislature w ith respect to a matter enumerated in List II of the Seventh Schedule. 10. There is no doubt that both Parliament and the State Legislature are supreme in their respective assigned fields. It is the duty of the court to interpret the legislations made by Parliament and the State Legislature in such a manner as to avoid any conflict. However, if the conflict is unavoidable, and the two enactments are irreconcilable, then by the force of the non obstante clause in clause (1) of Article 246, the parliamentary legislation would prevail notwithstanding the exclusive power of the State Legislature to make a law with respect to a matter enumerated in the State List. 11. With respect to matters enumerated in List III (Concurrent List), both Parliament and the State Legislature have equal competence to legislate. Here again, the courts are charged with the duty of interpreting the enactments of Parliament and the State Legislature in such manner as to avoid a conflict. If the conflict becomes unavoidable, then Article 245 indicates the manner of resolution of such a conflict. Thereafter, this Court, in para 12, held that the question of repugnancy between the parliamentary legislation and the State legislation could arise in following two ways:- â€Å"12. †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ First, where the legislations, though enacted with respect to matters in their allotted sphere, overlap and conflict. Second, where the two legislations are with respect to matters in the Concurrent List and there is a conflict. In both the situations, parliamentary legislation will predominate, in the first, by virtue of the non obstante clause in Article 246(1), in the second, by reason of Article 254(1). Clause (2) of Article 254 deals with a situation where the State legislation having been reserved and having obtained President's assent, prevails in that State; this again is subject to the proviso that Parliament can again bring a legislation to override even such State legislation. 51. In National Engg. Industries Ltd. v. Shri Kishan Bhageria [(1988) Supp SCC 82], Sabyasachi Mukharji, J. , opined that the best test of repugnancy is that if one prevails, the other cannot prevail. Case Study – Vijay Kumar Sharma V State Of Karnataka (Air 1990 Sc 2072) by Sayontika Das Part XI of the Indian Constitution describes the legislative relations between the States and the Centre. Article 254 to establish the doctrine of Repugnancy is one of the laws laid down under the Indian Constitution as a safeguard to solve disputes arising between the states and the Union. Repugnancy’ is meant to express ‘conflict’, whereby there is an expressed inconsistency between the State-made law and the Union-made law. Case details:Bench Majority opined- Mishra Rangnath, Sawant P. B and desenting view Ramaswamy. K. Relevant statutory provisions (i) Karnataka Contract Carriages (Acquisition) Act (21 of 1976); s. 14 & s. 20; (ii) Motor Vehicles Act 1988; s. 74 & s. 80(2); and (iii) The doctrine of Repugnancy: Article 254 of the Indian Constitution. Reference cases (i) Ch. Tika Ramji v. State of Uttar Pradesh (AIR 1956 SC 676) ; (ii) Hoechst Pharmaceuticals Ltd. v. State of Bihar (AIR 1983 SC 1019). Case Study: The doctrine deals with List (III) schedule (VII) which declares both the Union and State legislatures competent to legislate. However in case of conflict between the laws, the Union law will prevail if it is made within an entry of List (III), irrespective of whether it the Union law is made by before or after the State Legislature. According to Article 254 (1) an overriding effect is provided to the provisions of a Parliament-made law which the Parliament is competent to enact or in with respect to any matter as enumerated in the List III of Schedule VII. In such a scenario if any provision of a State-made law is in conflict with the Parliament–made law under such circumstance the State-made law is declared void to the extent of repugnancy. Under List III named as the Concurrent List in Schedule VII of the Indian Constitution both the Union and State Legislatures are competent to make laws on any of the entries mentioned therein. However they are subject to Clause (2) of Article 254 only in case, there is no conflict between the provisions of the said State-made law and a Central Act on the subject. However in case there is a repugnancy in question of a State law and Union law enumerated on one of the subjects of List III, the State law must yield to the Union law unless it has already been reserved for the assent of the President and has duly received so under Article 254 (2). The question of repugnancy therefore rightfully arises when there is a direct conflict between the provisions of the State law and the Union law on the same occupied field. Laws are said to be repugnant ideally when they get involved into taking responsibility for obedience to a higher authority. Simultaneously however certain inconsistent enactments to each of these laws may sometimes be possible without disobeying the other. Thus a suitable instance for repugnancy arises only when legislation falling in List III, the Concurrent List can be cured by resorting to Article 254 (2). The question of repugnancy under Article 254 arises when the provisions of both laws are fully inconsistent or are absolutely irreconcilable and it is impossible to obey without disobeying the other, or conflicting results are produced when both the statutes covering the same field are applied to a given set of facts.

Advertising and Marketing Research

Market research is any organized effort to gather information about markets or customers. It is a very important component of business strategy. [1] The term is commonly interchanged with marketing research; however, expert practitioners may wish to draw a distinction, in that marketing research is concerned specifically about marketing processes, while market research is concerned specifically with markets. [2] Market Research is the key factor to get advantage over competitors. Market research provides important information to identify and analyze the market need, market size and competition. Market research,as defined by the ICC/ESOMAR International Code on Market and Social Research, includes social and opinion research, [and] is the systematic gathering and interpretation of information about individuals or organizations using statistical and analytical methods and techniques of the applied social sciences to gain insight or support decision making. [3] Market Research is a systematic, objective collection and analysis of data about a particular target market, competition, and/or environment. It always incorporates some form of data collection whether it be secondary research (often referred to as desk research) or primary research which is collected direct from a respondent. The purpose of any market research project is to achieve an increased understanding of the subject matter. With markets throughout the world becoming increasingly more competitive, market research is now on the agenda of many organisations, whether they be large or small. The Market Research Process To conduct market research, organisations may decide to undertake the project themselves (some through a marketing research department) or they might choose to commission it via a market research agency or consultancy. Whichever, before undertaking any research project, it is crucial to define the research objectives i. e. what are you trying to achieve from the research? and what do you need to know? After considering the objectives, Market Researchers can utilise many types of research techniques and methodologies to capture the data that they require. All of the available methodologies either collect quantitative or qualitative information. The use of each very much depends on the research objectives but many believe that results are most useful when the two methods are combined. Quantitative Research Quantitative research is numerically oriented, requires significant attention to the measurement of market phenomena and often involves statistical analysis. For example, a bank might ask its customers to rate its overall service as either excellent, good, poor or very poor. This will provide quantitative information that can be analysed statistically. The main rule with quantitative research is that every respondent is asked the same series of questions. The approach is very structured and normally involves large numbers of interviews/questionnaires. Perhaps the most common quantitative technique is the ‘market research survey’. These are basically projects that involve the collection of data from multiple cases – such as consumers or a set of products. Quantitative surveys can be conducted by using post (self-completion), face-to-face (in-street or in-home), telephone, email or web techniques. The questionnaire is one of the more common tools for collecting data from a survey, but it is only one of a wide ranging set of data collection aids. Qualitative Research Qualitative research provides an understanding of how or why things are as they are. For example, a Market Researcher may stop a consumer who has purchased a particular type of bread and ask him or her why that type of bread was chosen. Unlike quantitative research there are no fixed set of questions but, instead, a topic guide (or discussion guide) is used to explore various issues in-depth. The discussion between the interviewer (or moderator) and the respondent is largely determined by the respondents' own thoughts and feelings. As with quantitative techniques, there are also various types of qualitative methodologies. Research of this sort is mostly done face-to-face. One of the best-known techniques is market research group discussions (or focus groups). These are usually made up of 6 to 8 targeted respondents, a research moderator whose role is to ask the required questions, draw out answers, and encourage discussion, and an observation area usually behind one way mirrors, and video and/or audio taping facilities. In addition, qualitative research can also be conducted on a ‘one on one’ basis i. e. an in-depth interview with a trained executive interviewer and one respondent, a paired depth (two respondents), a triad (three respondents) and a mini group discussion (4-5 respondents).

Report detaling organisational information,motivations for Essay

Report detaling organisational information,motivations for volunteering,work carried out evaluation of learning experience - Essay Example RMC’s mission is â€Å"to tackle urgent issues and disadvantage among asylum seekers, refugees & migrants and promote long term solutions to the problems they face.† The organisation also has a policy of helping everyone in the Black Country regardless of their mother country, ethnic, legal or religious affiliations. It also does not discriminate anyone on the basis of disability, age, gender or even sexual orientation. RMC is the only organisation of its kind and size in the entire region. It offers service and has its doors open to the most disadvantaged in the society. Beneficiaries of the organisation come from more than 120 countries. The organisations was founded some 15 years back and since then has been very positively impacting on thousands of persons seeking service. It has therefore grown over time into a very professionally capable organisation; has a sound management and therefore attracts and manages a wide range of different projects. Funding is mostly by charity trusts, lotteries, the EU, central and local governments and volunteers. RMC has over the time become an important part of various partnerships and is now enjoying a favourable reputation not only nationally but also regionally. One very important service offered RMC to its beneficiaries is migration is migration consultancy services for refugees with immigration issues. It also offers advice on citizenship as well as citize n preparation, guidance and counselling, housing & other social benefits and employment services. Considering the nature of work the RMC is engage in, volunteering is an integral part of the organisation. It therefore offers opportunities for individuals wishing to gain work experience, just do something rewarding with their skills or contribute to the organisation’s noble course. At RMC volunteering is also recognised as an opportunity for the organisation to impart new skills to the

Answer 6 question about Japanese Economy Essay Example | Topics and Well Written Essays - 750 words

Answer 6 question about Japanese Economy - Essay Example On the contrary, the American society has yet not adopted anime as a popular medium of advertisement, and advertisements made in America ensure they are not used in advertisements. A2. In the current era, Japan is known for its holistic views regarding product development. The Japanese way of product development consists of six items that makes it different from other economies. These six items include the factor of built in stability, self-organization of project teams, the concept of multi learning, management of subtle control, fostering a culture of organizational transfer of learning, and finally overlapping development phases. A4. One thing everyone knows of who has been to Japan is the high use of vending machines. There are many reasons for the abundance of vending machines within Japan; however, for the purpose of this essay we will shed light at a few important ones. To start off Japan is cash based economy, and unlike other countries cash based transactions are a norm in Japan. This makes buying from vending machines much easier and comfortable for people rather than having to particularly buy from a store which charges cards. Secondly, Japan is a relatively safe country with significantly low crime rates. This makes tampering vending machines less likely, and therefore highlights the possibility of boosting sales through vending machines practically anywhere. Most importantly what needs to be noticed here is that the Japanese people prefer walking long distance rather than taking cars, therefore this helps companies to boost their revenue by placing vending machines at various places so they can be used by passerby’s to purchase things as they walk. A6. Japan is one of the top economies of the world. However, despite this fact the country finds it significantly hard to attract talent across the globe. While there are many reasons for this problem, the bulk of these

American Politics Essay Example | Topics and Well Written Essays - 1250 words

American Politics - Essay Example A special attention is paid to the main role of mass media played in the formation of public opinion. In the process of election public opinion plays one of the most important roles. Officials to be elected should develop their electoral policies in accordance with shifted accents of basic public demands concerning the size of the government. For example, public policy may exert influence on development of liberal principles or democratic policies. Government responds to the needs shaped by the public opinion, because public opinion plays an important role in further development of policies (Jones, McDemott, 2009). Citizens have their strong beliefs that the Congress chosen by them would fulfill their needs and demands. Moreover, public opinion is investigated by sociologists and many other researchers in order to evaluate the needs of the citizens and make an analysis of further policies development. In terms of democracy, governmental responsiveness to public opinion is one of the basic pillars. On the other hand, if public opinion establishes broad parameters for the country’s policies and the policy entrepreneurs have a chance to develop their policies in a broader context. Governmental policies can be developed in broader terms and there is a need to respond to the set parameters of public opinion concerning liberal and democratic views and their reflection in the policies of the government. Further on, it is possible that public views are developed in a serious contradiction and key policy issues may not coincide with the public opinion. Question 2 Political parties and interest group are representatives of democratic process Under conditions of democratic processes of the country, it is evident that public opinion is reflected via different organizations and forms of public opinions. For example, interest groups are formed by the people, united by the common goal and they want to influence the formation of the governmental policies. Interest group s in America are established on the basis of their economic concerns, occupational needs or ideological beliefs or principles. These groups may be religious, ethnic or any other and may have membership in different social or economic groupings. People, who were frustrated by governmental policies, such as blacks, women, Native Americans and the economic underdogs have organized themselves in different movements (Jones, McDemott, 2009). They have their greatest power, because they reflect diverse interests and opinions and much more concerned about various beliefs and social concerns. Political parties are also important for governmental policy development as the instruments of policies formation. The role of political parties is very essential. These parties simplify voting choices and are responsible for competition organization, for electorate unifying and bridging the gap of powers separation. Voting choices are easily structured with the help of political parties and they nomina te a candidate for choosing him in the process of elections. Therefore, the function of political parties is much more integrative and in-depth strategies are taken by the political parties. Moreover, it should be noted that degree of effectiveness of interest groups and political parties is different. Interest groups are more specific and their representation and political influence is more limited than the influence of political par

Job satisfaction for MacDonald fast food restaurant Case Study

Job satisfaction for MacDonald fast food restaurant - Case Study Example Hamburgers, cheeseburgers, chicken, French fries, soft drinks, milkshakes and desserts are some of the items sold by McDonald's. Recently McDonald's has diversified its operations into many other areas. For example, â€Å"With the introduction of specialty coffee, McDonald's became more than just a fast food restaurant. Now you could come during the evenings and sit in the McCafe, sipping cappuccino while discussing the subtleties of 20th century French philosophy† (McDonald's: A History Of Innovation). â€Å"According to the National Restaurant Association, American sales of fast food totaled $163.5 billion in 2005. Total sales for McDonald's grew 5.6 percent in 2005, and the company now has 30,000 franchised stores in more than 120 countries†(Wilson).(See appendix for more details). In short, McDonald's is one of the rapidly growing organizations in the world. Even though recent recession hit many of the restaurant chains drastically, McDonald's escaped without any se rious injuries. At the same time, many people believe that the job satisfaction of the employees of McDonald's is not so good because of the demanding work culture. It should be noted that job satisfaction is an important entity for the workers of modern era. Any lapse in job satisfaction may result in increased turnover rate and the image of the organization could be spoiled. This paper conducts a SWOT analysis of McDonald's with respect to job satisfaction among employees. SWOT analysis Strengths A New York Times article chronicles the efforts of one McDonald's franchisee in Missouri who has outsourced his drive through order-taking to Colorado. According to the franchise owner, outsourced order taking allows him to handle 30 additional cars per hour. At the same time, the error rate in order taking was cut significantly as the ordering process has become more efficient and accurate (McDonald's: A History Of Innovation). Innovation is the major strength of McDonald's. The company never hesitated to incorporate modern business strategies and servicing techniques in its premises. It should be noted that outsourcing and offshoring are two of the most modern business strategies adopted by modern organizations to exploit the globalized business climate. As mentioned earlier, internationalization of offshoring of business helped McDonald's to establish business in more than 120 countries at present. it should be noted that the business in America is almost saturated for McDonald's at present since it has outlets in virtually every corner of America. It is impossible for McDonald's to expand further in America. Because of the above awareness, the company started internationalization of business, which brought dividends to them. Same way, out sourcing also helped the company immensely in increasing its revenue. Many people have the illusion that outsourcing may help only the manufacturing industry and it has nothing to do with the service industry. However, McDonald 's proved such belief wrong. It has outsourced the majority of the order taking jobs. It should not be forgotten that it is extremely difficult in America and other European countries to find enough labor to work in lower level positions. Manpower shortage is immense in these regions and hence companies forced to outsource their jobs as much as possible. Outsourcing of order taking and order processing helped McDonald's to improve its operating efficiency immensely. Previously, the

The Difference Between Management And Leadership In School System Essay

The Difference Between Management And Leadership In School System - Essay Example This essay discusses leading for change in the education sector, and also the contribution that teacher leaders can make to school leadership. It examines the type of leadership required and highlights some important differences between management and leadership. Management concerns the process of dealing with, controlling and being responsible for all activities and operations of an organisation. It involves coordinating all members and resources belonging to the organisation according to their potential, and the attempt is to be as efficient and effective as possible. Usually, aims and objectives are defined, planning is undertaken, and the progress is monitored. There is therefore, a focus on structuring, In the UK school system, the managerial tasks in schools are mostly handled by the head teacher, although some may be delegated to deputy heads and/or subject co-ordinators. Leadership places a great emphasis on personal qualities and how leaders influence others. Leadership is n ecessary for organisations in general because without it, an organisation fails to have vision, direction, order and discipline, and consequently, the performance of individuals within the organisation varies and they are unable to exploit their full potential. There are several forms of leadership, which differ in their style although they all share the essential qualities of leadership. Transformational leadership is one very popular form of leadership. In this form, there is a greater attempt to bring about changes to achieve certain goals.

Does The Internet Affect Body Practice and Culture Essay

Does The Internet Affect Body Practice and Culture - Essay Example Currently, many people gain access to effective communication in their daily lives. Cultures have come to believe that instead of purchasing a radio, they would rather buy cell phones since the modern technology has made cell phones more accessible than radios. Advanced cell phones come with access of television networks. Therefore, many people consider owning one of the electrical products as a means of reducing complexity (Greenblatt 35). The internet and the workplace The current place of work in majority of organizations worldwide is changing at a fast rate. The workplace is turning out to be huge as the business surrounding increases in terms of demographic and financial aspects. Nevertheless, comprehending means by which effective communication can be made is the difficult part that these organizations encounter. The workplace consists of people who talk using different languages to arrive at a common objective. Cross-cultural communications approaches are hence being implement ed in these organizations for effective management and communication purposes (Durham & Kellner 98). One cross-cultural communication strategy is introduction of the new norm. The internet and advanced technology fall in the category of new norms being adapted by numerous multinational corporations. The internet has created novel markets for the organizations, not to mention permitting the promotion of these organizations to new demographic locations and traditions. Given technological advances such as the internet, the staff can communicate remotely making cross-cultural communication the new norm (Greenblatt 51). Another cross-cultural communication approach enhanced by organizations involves accepting cultural diversity. Novel communication confrontations are brought about by various traditional backgrounds in the place of work. These differences are currently considered in an effort to maximize communications between the staff (Greenblatt 69). Another cross-cultural communicatio ns strategy enhanced by organizations is the development of responsiveness of particular cultures. Some organizations have opted offering basic lessons of the various cultures that make up the staff. Such a strategy will provide knowledge on the proper greetings and bodily contact; a difficult field in inert-cultural training (Greenblatt 77). Demanding tolerance is another cross-cultural communications approach enhanced by organizations. Demanding open-mindedness can be easily implemented through the cultivation of little knowledge towards the employees. Different employees should be handled in different manners through the provision of different information that will properly address all the cultural demands for effective communication to take place. Electronic data interchange (EDI) will enable the company to place orders or administer inventories, this result in cutting of stock inventories thus saving millions on the cost of maintaining it can also be applied to procurement of p roducts. The internet also enables customers to transact business directly with the company through the internet saving time and reducing the operational costs. In addition, the company’s business transactions with its suppliers and contractors are eased. With the internet, people can purchase items such as books and clothing, furniture and groceries through a website. Even servicing a car or making a doctor’

Evaluation Essay Example | Topics and Well Written Essays - 1000 words - 2

Evaluation - Essay Example Parents are overworked and stressed at levels unseen in recent times; they are working longer hours, sleeping less, and are faced with challenges their own parents did not face. This along with the greater numbers of single parent and dual income households means that the parents are stretched to their limits. The television is a convenient babysitter allowing these parents a minute or two to cook dinner, clean the house, and whatever other duties they need to complete daily. It is easy to tell a child to turn the television on, assured that they will sit there and be entertained. It requires a minimum of supervision, and ensures that there will be relative quiet while they are watching. I am guilty as are most mothers I know of allowing the television to help me with my children too often. I worry that if they play outside the serial killer lurking beneath the neighbor’s bushes may grab them. If they are in the house, as least I know they are safe. We have all heard too many stories of children that were left unsupervised for â€Å"just a minute† and were then gone. My mother has told me stories of when she was growing up, they were let loose all over the town to ride their bikes until dark as young as 7 or 8. Mothers in this day and time cannot comprehend allowing their children out of their site for long periods of time, let alone all day roaming over the entire town. We have to be more cautious because there are more predators now than ever before. So, if we don’t have the time to watch them outside, it is easiest to keep them safe inside in front of the T.V. . Television in small, monitored doses can be good for children. Certainly not all television is bad. Educational programming allows them to learn things they might not have had the opportunity to learn otherwise. It also shows them far away places so that the world seems a little smaller, and they experience more of it. However, the American Association of Pediatrics recommends no more

Thoreau and Martin Luther King, Jr. Essay Example for Free

Thoreau and Martin Luther King, Jr. Essay . Drawing on Thoreau and Martin Luther King, Jr., defend or attack the practice of â€Å"Civil Disobedience† in a democratic society such as ours. Civil disobedience is not only a crucial tool that the masses use to express their grievances against an unjust government, but it is a necessity for the social health of any society.   Citizens can only respect a country worthy of respect, with or without rule of law dictating behavior.   The rule of law may retain order, but may also be seen as unjust or unnecessary by those are forced to submit to it.    Since Thoreau’s treatise on civil disobedience, nonviolent protest has been used by many movements such as the civil rights movement to affect change, and must continued to be employed as a tool to ensure that people retain the power over the government. Civil disobedience has been a successful tool in initiating change in many countries, including the United States.   Civil disobedience is generally comprised of a majority group that represents the voice of those who are adversely affected by injustice and is mostly nonviolent, usually in the form of protesting.   Henry David Thoreau discusses the subject of civil disobedience when talking of his own efforts to make a nonviolent protest:   â€Å"All men recognize the right of revolution; that is, the right to refuse allegiance to and to resist the government, when its tyranny or its inefficiency are great and unendurable† (Thoreau). When a government or ruler fails to treat all citizens equally, citizens must mobilize to voice grievances when they decide that the governmental system is not ideal.   Analysis of the history of civil disobedience reveals that leaders of such movements have always advocated against violence, preferring peaceful measures as a main weapon.   Peaceful weapons have been proven more effective in changing the systems and achieving national and individual freedom.   Civil disobedience utilizes a system of protests, from boycotts to strikes, that always seek to remain true to non-violent ideals.   The ultimate goal of civil disobedience is to initiate systemic change. Civil disobedience is driven by a motive of correcting the wrongs and demand for equality and justice. Unlike other movements, the motive of civil disobedience is not to dictate or oppress others.   It is a system of protest, driven more by intelligence than force.   The question of attacking or killing has no place in civil disobedience, which aims at willingly and peacefully breaking the law.   As a civil disobedience movement gathers momentum, the government it is opposed to is bound to be crippled and ruptured, and ultimately changed by the movement.   During the twentieth century, this was used successfully in India to liberate the country from colonial rule. Indian spiritual and political leader Mahatma Gandhi believed in Satyagraha, the philosophy of non-violent resistance.   He used it to drive the most powerful empire in the world out of his country, achieving independence and proving to the rest of the colonial world that peaceful resistance could initiate change.   Gandhi passionately advocated nonviolence and peaceful protesting, and provided guidelines on civil disobedience.   Some of Gandhi’s guidelines included that resisters would harbor no anger, or suffer the anger of the opponent, putting up with assaults, though never retaliating. Civil resisters would not submit, out of fear of punishment or the like, to any order given in anger, and they would also accept arrest, the loss of property, and adherence to all other laws as dictated by authorities.   However, if a civil resister has any property in is possession as a trustee, he will refuse to surrender it, even though in defending it he might lose his life.   He will however, never retaliate, insult his opponent, nor submit to the pomp and circumstance accompanying allegiance to the government being opposed. And, as part of Gandhi’s guidelines, a civil resister will even protect opposing authorities from any violence that might be perpetrated upon them (Gandhi).   With Gandhi’s guidelines for civil disobedience, one can clearly see that rule of law is a careful consideration to those wishing to peacefully affect change.   Only decades after Gandhi’s successful campaign of nonviolent civil disobedience against the British, in the United States, Martin Luther King inspired millions of African Americans to employ civil disobedience to achieve equal rights. Martin Luther King adhered to Gandhi’s guidelines for civil disobedience to protest segregation and helped ensure equal rights for African Americans in the process.   King espoused his philosophy on civil disobedience in a letter he wrote sitting in a Birmingham jail.   The religious leaders who opposed the peaceful demonstrations in Birmingham representing various denominations united in disapproval stated their belief that protestors should not break local laws while demonstrating for their cause. Dr. King replied to this charge with a powerful question about justice:   â€Å"One may well ask, ‘How can you advocate breaking some laws and obeying others?’ The answer lies in the fact that there are two types of laws: just and unjust.   One has not only a legal but a moral responsibility to obey just laws.   Conversely, one has a moral responsibility to disobey unjust laws.†Ã‚   He supports this in later paragraphs by suggesting that the Constitution represents a just law that has been unevenly applied, allowing the unjust laws of segregation to remain in force and leaving a blot on the absolute fairness of our founding principles. Written from jail after King was arrested for practicing civil disobedience, a ‘Letter from Birmingham’ espoused his views on rule of law that enabled social injustice and how it must be opposed: â€Å"In   any   non   violent   campaign   there   are   four   basic   steps: collection   of   facts   to determine   whether   injustices   exist, negotiation, self-purification   and   direct   action. We have gone through all these steps Birmingham. There   can   be   no   gainsaying   the   fact that   racial   injustice   engulfs   this   community. Birmingham   is   perhaps   the   most thoroughly   segregated   cities   in   the   United   States. Its ugly record of brutality is widely known. Negroes have experienced grossly unjust treatment in courts. There   have   been more   unsolved   bombings   of   Negro   homes   and   churches   in   Birmingham   than   any   other   city   in   the   nation. These are hard brutal facts of the case. On   the   basis   of   these conditions, Negro   leaders   sought   to   negotiate   with   the   city   fathers, but   the   latter consistently   refused   to   engage   in   good-faith   negotiation† (King). To King and other civil resisters, it   is   the   right   of   every   individual   to   fight   for   justice   and equality by   the   virtue   of his   very   birth, putting it forever opposed to any rule of law considered unjust.   And, as Dr. Kings bedrock principle was nonviolent social change, he and his followers were beaten, blasted with fire-hoses, and jailed without ever striking a retaliatory blow.   Their willingness to suffer the consequences of their actions showed an admirable respect for the rule of law in America.   The letter states, One who breaks an unjust law must do so openly, lovingly, and with a willingness to accept the penalty. I submit that an individual who breaks a law that conscience tells him is unjust and who willingly accepts the penalty of imprisonment in order to arouse the conscience of the community over its injustice, is in reality expressing the highest respect for law (King).   By paying the price for civil disobedience, the Birmingham protestors were able to take the moral high ground from those who hid behind the strict interpretation of the law.     While Dr. King is sure to warn against anarchical views of his statement to disobey laws, his argument against following unjust laws is sound and easy to understand. Injustice and inequality can exist under rule of law, and civil disobedience is the best non-violent way to oppose the responsible government.   While breaking any law is technically outside the rule of law, civil disobedience cannot be considered consistent with true unlawfulness.   Lawmakers are not always sane, equal, or fair, and often prone to error in framing laws, and civil disobedience is the best way to use the law by breaking it. While   civil   disobedience   is   not   consistent   with   the   rules   of   law, injustice and inequality seems to continued unabated, and the natural right of an individual is to oppose such laws.   Civil disobedience will remain an effective method of opposing rule of law considered unjust, though determining justice may prove to be the most difficult part of the process, as well as the most important. Works cited: Gandhi, Mahatma. Nonviolent Resistance. 1961. King, Martin Luther.   â€Å"Letter from a Birmingham Jail [King Jr.].† African Studies Center – University of Pennsylvania. 16 Apr 1963. 25 Apr 2008. http://www.africa.upenn.edu/Articles_Gen/Letter_Birmingham.html. Thoreau, Henry D. â€Å"Henry David Thoreau’s ‘Resistance to Civil Government’ (1849) or, ‘On the Duty of Civil Disobedience’.† The Transcendentalists.   2008.   25 Apr 2008 http://www.transcendentalists.com/civil_disobedience.htm.

Performance appraisal methods Essay Example for Free

Performance appraisal methods Essay In order to succeed in the market, companies need to ensure they provide efficient management of human resources. Companies can perform well only in such a case when all of the employees are able to realize their potential, apply their skills and make sufficient contribution to the development of the company. Performance appraisal is particularly important for all of the organizations because it enables them to determine the contribution of every employee to the performance of the company. Performance appraisal is currently one of the most important issues in human resources management which â€Å"continues to be a subject of interest and importance to human resource specialists. † (Hornsby et al. 1996, p. 10). Bernardin Klatt (1985); Hall, Posner, Hardner (1989); Maroney Buckley (1992); Thomas Bretz (1994) have all devoted considerable attention to the development of theoretical models of performance appraisal. How can a manager of the organization make a conclusion about the necessity to promote this or that employee, increase of decrease his salary, shift him to another department? How can the manager decide which employee needs special training or which can perform on the highest level without additional training? The most efficient tool in such a case is performance appraisal. If carried out correctly and on the basis of efficient methods, performance appraisal can be very helpful for the evaluation of employees’ work. â€Å"Companies that hope to succeed in todays competitive business environment must learn to identify their most capable employees for placement in key organizational appointments. To do this, managers should devote more attention to maximizing the effectiveness of performance appraisal systems. (Mcbey 1994, p. 23). Appraisal methods for the performance of the customer care supervisor in Fabulous. com require both the application of generally recognized methods of performance appraisal and their slight adjustment to the specification of the position. On one hand, this position needs to be appraised with the help of commonly used principles and methods. On the other hand, it requires deep understanding of the functions which customer care supervisor needs to perform daily, his responsibilities, all of the complication which can occur in the process of the fulfillment of his responsibilities. The choice of appraisal methods needs to be guided by the specifications of the position. In order to make a decision about the appraisal method which will be used for the position of customers care supervisor, it is necessary to analyze all of the most well-known methods of performance appraisal in relation to their effectiveness for this position. What needs to be kept in mind is that there is no possibility to find one completely efficient method. All of the methods will have both advantages and disadvantages. After more than 30 years of serious research†¦ it seems that little progress has been made in developing an efficient and psychometrically sound alternative to the traditional graphic rating scale. One major conclusion to be drawn from this research is that there is no easy way to get accurate and informative performance data. † (Rice 1985, p. 30). Even though there is no possibility to determine a completely accurate method, some tools of performance appraisal need to be used in any case because â€Å"timely, useful, and accepted feedback can help individuals make great strides toward optimal performance. (Coyens, Jenkins 2001, p. 34). Comparative standards include straight ranking method; alternative ranking method; paired comparison method; forced distribution method. All of these methods are inappropriate for the position of customer care supervisor due to the specifics of his activities. Comparative standards can be very efficient for the types of job in which employees need to do exactly the same kind of work and it is possible to tell the differences between their performance. However, the position of customer care supervisor is created in order to maintain a solid relationship with customers and supervise all of the major activities dealing with customer service in the company. This is not the type of job in which employees’ performance can be compared because it is hard to find the criterion of comparison in such a case. Comparative standards application in performance appraisal of customer care supervisor would lead to inaccurate results. Besides, in customer care it is particularly important to make emphasize on the further improvement of performance of the supervisor. Comparative standards do not provide any information on that point. The straight ranking method is the simplest and the most inaccurate because it only enables to compare employees. It does not let the appraisers to perceive the qualities of the employee himself. Alternative ranking method, paired comparison method and forced distribution methods can all be used in manufacturing companies and organizations of similar type but they will be completely useless when appraising customer care supervisor at Fabulous. com. Absolute standards include narrative essay; critical incidents method; weighted checklists; forced choice; Behaviorally Anchored Rating Scales (BARS); Behavioral Observations Scale (BOS). â€Å"With this style of appraisal, managers use written, absolute standards. Reviews are not based upon relative standing of the employee in a specific work group. Absolute methods facilitate intergroup comparison of employees in an organization. † (Mcbey 1994, p. 11). They are more efficient and could be applied for performance appraisal of the position of customer care supervisor. However, they have many disadvantages which need to be discussed. Narrative essay generally could give a good idea about the employee working at the position of customer care supervisor. However, it is more a qualitative description than a quantitative method of appraisal. It would not provide all of the important data about the performance of the employee. Critical incidents method is efficient only to some extent because it provides information about the employee’s behavior only in critical situations. The work of customer care supervisor does not always consist of critical situations, in fact, they are quite rare. That is why there is no sense the measure the employee’s performance with the help of this method. Weighted checklists can be useful but they have a very large impact of the appraiser’s opinion, and weighting coefficients can sometimes be applied incorrectly. Forced choice is not the most efficient method to be applied for the case of customer care supervisor because this method does not meet developmental needs and does not allow the appraiser to interpret the ratings correctly at times. Behaviorally Anchored Rating Scales (BARS) are used quite frequently nowadays. BARS uses expected performance levels as a basis for the appraisal. Behavior is judged by a job analysis and comments from those in the same or similar jobs. Behavioral statements are developed for each job in the organization and are anchored by numerical scales. † (Mcbey 1994, p. 12). However, this method has some important disadvantages. â€Å"Although BARS provides excellent specific behavioral guidance for employees, it is among the most complex and difficult performance appraisal system that can be introduced, especially for smaller organizations without significant human resource staff capabilities. † (Mcbey 1994, p. 2). Other authors also point at the complexity of this method: â€Å"While advocates of BARS, particularly the consultants who do a thriving business with it, claim its a great leap forward, critics point to several drawbacks. The lengthy job analyses and complex scale construction require a major investment of a companys time and money. A scale designed for use in one department may not apply in another. † (Rice 1985, p. 32). In our opinion, there is no sense to apply very complicated performance appraisal techniques in our case because the position which is being analyzed is not the key position in the company. Such complex techniques should rather be used for employees occupying positions of senior- and top management. Behavioral Observations Scale (BOS) are very similar to BARS in their complexity. â€Å"The BOS system observes past performance as the standard for appraisal. BOS offers many of the same benefits as BARS, most notably concrete examples to guide employee behavior and developmental difficulty. † (Mcbey 1994, p. 13). The application of this method is also not efficient for the position which is being analyzed due to its over-complexity. Objectives-based approaches include Management by Objectives (MBO) and work standards approach. These approaches are the most suitable for the performance appraisal of the customer care supervisor because it is particularly important for the employee in the position to achieve his goals. There are types of jobs in which the goals are pre-determined for many years ahead of time: for example, a salesperson needs to ensure he or she sells as much merchandise available in the store as possible. There are no adjustments of this goal or any corrections because it is universal. The position dealing with customer care and maintenance of successful relationship with customers is very challenging and deals with change in many aspects. The goals constantly need to be re-adjusted according to the needs to customers. The capability of the customer care supervisor to achieve all of the goals is the measurement of his success in this position and his adequate performance. There can be no better appraisal methods for this position than objective-based approaches. Management by Objectives (MBO) is very useful in this case. â€Å"MBO became popular because, in theory, it can be tailored to each individual job and because it lets subordinates know how their performance will be measured and gives them specific, mutually-agreed-on goals. (Rice 1985, p. 33). Its mechanism is relatively simple. â€Å"As customarily practiced today, supervisors and their subordinates sit down at the beginning of each year, or every six months, and agree (often in writing) on specific goals to be accomplished. At the end of the period, the supervisors evaluate their subordinates in terms of how well they have met those objectives. † (Rice 1985, p. 33). Work standards approach is similar to MBO except that organizations determine goals and appraisal techniques on the basis of their past experience. Of course, there are some disadvantages of this method which need to be taken into consideration. For example, â€Å"one major weakness is the difficulty of setting reasonable goals well in advance, when they may be vulnerable to factors outside the employees control, such as economic conditions, labor problems and price increases. † (Rice 1985, p. 33). At the same time, this disadvantage can be interpreted as an advantage in such a case if the goals are constantly re-adjusted according to the needs of the consumers. In such a case, the performance appraisal method will work efficiently.

Genetic Variation of Taste Receptors

Genetic Variation of Taste Receptors Abstract: The people have different behaviour to choose the food, and there are many factors that affect the food choices. The best significant factor to choose the food is taste. Differences in taste perception of several taste modalities are associated to difference in the taste receptors. Polymorphisms of the genes that encoding these taste receptors may clarify these unpredictability in taste perception. Individual changes in the capability to identify bitter tasting compounds, such as phenylthiocarbamide (PTC) was a well-known example of this variability. This difference divided the people in two groups: tasters and non-tasters, and is because of in part to single nucleotide polymorphisms (SNP) of a bitter taste receptor gene, taste receptor, type 2 (TAS2R) 38. The experiment was designed to determine the PTC phenotype and genotype, the SNP at position 785 is of particular importance in genotyping. DNA was extracted from check cell by using Chelex technique and genotyped by using polymera se chain reaction (PCR) followed by restriction fragments length polymorphism (PCR-RFLP). A 2% of Agarose gel electrophoresed and stained with Ethidium Bromide to imagine the genotype pattern. The class was tasted PTC test paper to compare phenotype and genotype. The total was 108 students the genotype showed 21 taster (+/+), 51 was mild taster (+/-) and 36 was nontaster (-/-). The allele frequency was not statistically significantly differ from European population. Therefore, TAS2R38 genotype is a truer estimation of the extent of the influence of this single gene on taste perception of PTC in a genetically diverse population. Introduction: Taste perception is the most sensitive predictor of how much a food is pleasant and unpleasant. The people are different in the taste perception of sweet, bitter, sour, or salty tastes which could influence the dietary behaviour (2, 3, 4). The variations in the taste perception between the individuals may relate to a variation in the gene taste receptors (2). The gene family of the taste receptors are encoding from TAS1R and TAS2R. The bitter taste receptors are include the TAS2R38 and TAS2R550. While the umami and sweet taste receptors is the TAS1R. The sour taste receptors are the PKDIL3 and PKD2L1. The genetic variation in these receptors may causes to deferential favourites for some types of food. Phenylthiocarbamide (PTC) compounds is the example was more studied in the variation of the sensitivity of taste as the bitterness (2, 5). The TAS2R38 gene is one of the most studied from over twenty-five in bitter taste receptor gene (4).The TAS2R38 gene is responsible for the taste perception of PTC as more bitter and the other related compounds like 6-n-propylthiouracil (PROP) which both contain a group of thiourea (7.8). The variation in the gene TAS2R38 divided the individuals in two groups of thiourea tasters: tasters and non-tasters (4, 5). Phenylthiocarbamide (PTC) The variation in the taste perception of PTC rely on the genetic studies. In 1930s, difference in the ability to taste PTC was first finding by Arthur L. Fox in a laboratory accidental (6). When he was working in the laboratory and transferring PTC powder into a bottle. Some particles of PTC powder flew into the air and his colleague close to him C. R. Noller tasted the particles as bitter but Fox tasted nothing. Fox was make experiment to test a large number of individuals and he found the difference in their ability to taste PTC and he divided the people in two main groups’ tasters and non-tasters (1). Worldwide about 25% of population classified as ‘non-tasters’ and the remaining 75% as ‘tasters’ (1). In addition, Bartoshuk et al, in 1992, discovered that the ‘tasters’ varied in the perception of PTC/PROP in a bi-modal fashion, and they separated them into medium tasters and supertasters. The supertasters were very sensitive to PTC, pe rceiving them as more bitter, while the medium tasters may taste PTC and found it mild bitter. Besides, the spread of super, medium and non-tasters in the general population is roughly 25%, 50% and 25%, respectively (1). The PTC sensitivity believed to be inherited as a simple Mendelian trait with two alleles a dominant trait (T) for taster and recessive trait (t) for non-taster (9). Figure 1: shows the inheritance of PTC trait. PTC genotype TAS2R38 or PTC gene is located on chromosome 7q and consists of a single coding exon 1002 bp long, encoding 333 amino acids, 7-transmembrane domain G-protein-coupled receptor (2, 6). A number of SNPs have been identified within this gene, the three most common SNPs (>1% of the population has variants at a specific DNA sequence, considered an SNP and (4).Also, the PAV/PAV homozygotes are sensitive to PTC more than PAV/AVI heterozygotes while AVI/AVI homozygotes are fewer sensitive (4). The AVI haplotypes in the non-tester differ at 3 SNPs from the PAV haplotypes of the tasters (9). The aim of this practical: To focus on the TAS2R38 genotype and its link with the ability to taste PTC test paper. The SNP at position 785 is of specific concern in genotyping. Comparing the allele frequency detected in the class with those observed in European population subject in group 226 and Sub-Saharan African subject in group 224. Material and Methods: To determine the TAS2R38 (A262V) genotype by using the polymerase chain reaction (PCR) and restriction endonuclease digestion, Fnu4H1 enzyme. The procedure that has been done was as the following: Protocol of DNA Extraction from Cheek Cell (scrape or wash): First week take a 10 ml of water pour into mouth and swirl to release buccal cells and spit back contents into tube. Centrifuge the tube at 3000rpm for 3 minutes, carefully pour off supernatant and retain cell pellet. Added 350Â µl of 5% Chelex mix and then transfer the pelleted buccal cells to new (1.5ml) Eppendorf tube. The 5% Chelex to protects DNA breakdown under a high temperature. Added 4Â µl of proteinase K to the Eppendorf tube that contains buccal cells and 5% Chelex. Incubated the tube containing chelex/cells at 56Â °C for 30 minutes in the heating block, then briefly vortex the tube for 10 seconds after that centrifuge the tube at 3000rpm for 20 seconds. Incubated the tube ( chelex/cells) again in heating block at 98Â °C for 15 minutes, then vortex the tube for 10 seconds, after that centrifuge for 3minutes.Transferred the supernatant that above the chelex containing the buccal cell (DNA template) into the sterile 1.5ml Eppendorf tube and measured the DNA concentration by take 1Â µl of DNA into machine called nanodrop nucleic acid then kept at -20Â °C to preserve the DNA. Protocol of Phenyl Thiocarbanate(PTC) using PCR Reaction: Second week take a 43.5Â µl of master mix was already prepared in the PCR tube and transferred 6.5Â µl of DNA extraction. (Buccal cell DNA).Vortex and spin the tube to make the liquid contents to bottom of the tube. The total PCR tube reaction volume contain 50Â µl of mixtures were placed in the PCR machine and the thermal cycler conditions were: cycle of 94Â °C for 4 minutes. The 40 cycles of 55Â °C for 40 seconds, 72Â °C for 40 seconds and 94Â °C for 40 seconds .Then 1 cycle of 55Â °C for 5 minutes and at 72Â °C for 5 minutes. The sequence of Forward primer was 5’ AACTGGCAGAATAAAGATCTCAATTTAT3’ The sequence of the Reverse primer was 5’ AACACAAACCATCACCCCTATTTT 3’. Restriction Digestion (Fnu4HI): Last week transferred a 20 ÃŽ ¼l of the component mixture (PCR product) to a tube containing 10ÃŽ ¼l of the restriction endonuclease master. The tube was placed in into a 37Â °C heating block for two hours. Electrophoresis of PCR Products: A 30ml of 2% Agarose gel with 0.5Â µl/ml of ethidium bromide was loaded into the gel tank with adjusting the comb, the gel was kept 15 minutes to get stuck. After that the TBE buffer was loaded, covering the surface of the gel and the comb was removed. Take 12Â µl of PCR product undigested and digested into two different tubes added 3Â µl of DNA loading buffer mix and spin. Then, 10ÃŽ ¼l of PCR product/loading buffer was loaded into the well of 2% Agarose gel and 10ÃŽ ¼l of the ladder (100bp) was added in the last well. The gel electrophoresed at 90 volt for 45minutes, negatively charged (-ve) DNA moved toward the anode side (red). Last take gel photograph under UV trans-illumination. Taste tests: The PTC taste test paper was used to observe the capability to identify the bitterness of PTC and its relative with the TAS2R38 genotype. Statistical analysis: The data of the allele frequency for C785 and T785 observed in the class was compared to the allele frequency of European population subjects in group 226 and Sub-Saharan African subject in group 224 by using the Chi square test. The Chi square test was also used to investigate the association between the TAS2R38 genotype and phenotype. All statistical analyses were performed with Minitab data analysis software. References Feeney E. The impact of bitter perception and genotypic variation of TAS2R38 on food choice. Nutrition Bulletin. 2011; 36(1):20-33. Wooding S, Kim U, Bamshad M, Larsen J, Jorde L, Drayna D. Natural Selection and Molecular Evolution in PTC, a Bitter-Taste Receptor Gene. The American Journal of Human Genetics. 2004; 74(4):637-646. Chaudhari N, Roper S. The cell biology of taste. The Journal of Cell Biology. 2010; 191(2):429-429. Feeney E, OBrien S, Scannell A, Markey A, Gibney E. Genetic variation in taste perception: does it have a role in healthy eating? Proc Nutr Soc. 2010; 70(01):135-143. Lalueza-Fox C, Gigli E, de la Rasilla M, Fortea J, Rosas A. Bitter taste perception in Neanderthals through the analysis of the TAS2R38 gene. Biology Letters. 2009; 5(6):809-811. Kim U, Drayna D. Genetics of individual differences in bitter taste perception: lessons from the PTC gene. Clinical Genetics. 2004; 67(4):275-280. Dotson C, Shaw H, Mitchell B, Munger S, Steinle N. Variation in the gene TAS2R38 is associated with the eating behavior disinhibition in Old Order Amish women. Appetite. 2010; 54(1):93-99. Duffy V, Davidson A, Kidd J, Kidd K, Speed W, Pakstis A et al. Bitter Receptor Gene (TAS2R38), 6-n-Propylthiouracil (PROP) Bitterness and Alcohol Intake. Alcoholism: Clinical Experimental Research. 2004; 28(11):1629-1637. Merritt R, Bierwert L, Slatko B, Weiner M, Ingram J, Sciarra K et al. Tasting Phenylthiocarbamide (PTC): A New Integrative Genetics Lab with an Old Flavor. The American Biology Teacher. 2008; 70(5):e23-e28. Appendix

Internet Privacy :: essays research papers

Internet Privacy: Is the Internet as safe as everyone says? As every generation comes they bring with them a new invention from cars to television to the telephone the basic existence of man, in my eyes, is to advance both technologically, thus making life better for us all and also scientifically. Man wants to know all we want to be able to answer all the questions out there as every day goes by we get closer and closer to answering some of our questions. Everyday new cures for diseases are found and also new diseases are discovered, new discoveries are made in various fields, at the same time however new problems are arising. Man in every era has depended on some form of tool to help him to his tasks whatever they may be, a tool to make things easier. This tool is technology; technology does not have to be the modern thoughts of computers. Technology is "the science of technical processes in a wide, though related field of knowledge." That is the definition given by The New Lexicon Webster's Dictionary of the English Language. So technology can be anything as long as it helps us advance. It can be anything like a plough to help a farmer, a television to help the media and the telephone to help us communicate. The latest technology of the 20th Century is the Internet and it has placed a great mark on our society. It is the new "place to be" where business can advance, people can interact worldwide at the click of a mouse and this has revolutionarily changed the world. In the world of the Internet there are millions of members worldwide and that means it is a very profitable arena. In an area where there is money there are criminals and that is where the modern criminals of the world are behind computer screens. They may be credible individuals in society and they could also be credible corporations and organizations that are finding a quick way to make money and by doing this they are breaking ethical rules of society (even though it is hard to determine the ethics of the internet) and one of these crimes is the violation of the privacy of others. I have logged on to the internet and have felt safe, like anyone should that logs on to the net, that I am the only one viewing my mail or cruising the net, I feel like I am the only one that knows where I have been and that no one is tracking me.

I never finished anything :: essays research papers

I never finished anything in my life. To date, I have projects that I started and never finished. Nothing in my life had ever struck a cord in my mind so fiercely I was compassionate enough to drive myself to the brink of insanity to accomplish it. I guess I just want fulfillment, but I only feel a void big enough to fit in Crater Lake. I always wanted to play an instrument. In 7th grade I got a chance to. I started playing the Viola. I was instantly great at it. I practiced and practiced my heart out. I even achieved a superior on a solo I performed at a Solo and Ensemble competition. It started to bore me. Then I quit. Do I regret it? Yes, but I can’t go back. It’s just another useless skill I have. In 6th grade, I wanted to be an actress. I studied drama for 3 years in middle school. Many nights I stayed up practicing and racking my brain to the point of a headache trying to memorize line after line. I was in a couple of plays, and even scored a superior in a Junior Thespian Competition for Ensemble acting. I still have the pin I received. I also directed my 8th grade drama class’ play called Break. I haven’t performed since. Again in middle school, I took a dance class. I wanted to become a dancer very much. I learned ballet, hip-hop, jazz, and many other types. I didn’t have much skill in that area. I wasn’t as near as talented as the other girls, and the occasional guy. I quit after a year. I don’t have any regrets in that area, none what so ever. In 8th grade, I was going to participate in the school wide science fair, but that never happened. I had an interesting topic; â€Å"Do your fingerprints tell what hair color you have?† I bought all the supplies, and had the backing of my science teacher Mr. Van Brunt. I never completed it. I wish I did. I took golf lessons about year ago. I didn’t show much promise though, Paid 100$ for them too. Due to recent happenings, I grew into a deep depression at the time. Out of 8 weeks, I only completed 5 or 6. Now I prefer online golf, it’s not as frustrating. This year, I was on the color guard team: the Titanettes.

Knowledge M Essay -- essays research papers

Introduction   Ã‚  Ã‚  Ã‚  Ã‚  In today’s economy, corporations are constantly seeking was to achieve faster decision making, higher levels of product, better service, and process innovation to gain competitive advantage over other corporations. Various information technologies have been adapted in to corporation’s business plans in order to optimize competitive advantage. However, with the increase in competition, information technology’s applications in business no longer serve as a great advantage. The need for new business strategies arises along with the emergence of the knowledge society (Styhre, 2003) having information is no longer a source of competitive advantage. In today’s business environment, organizational knowledge is recognized as a significant source of competitive advantage, how quickly organizations determines knowledge and creates value out of it determines its competitiveness. (Shukla) In an economy where the only certainty is uncertainty, the one sure source of competitive advantage is knowledge. When markets shift, technologies proliferate, competitors multiply, and products become obsolete almost overnight, successful companies are those that consistently create new knowledge, disseminate it widely throughout the organization, and quickly embody it in new technologies and products. -Harvard Business Review (1998) Knowledge management is a business strategy that identifies, organizes and shares information essential to the company so it can be applied to optimize business performance. The content of this paper provides the fundamental concepts to the practice of Knowledge Management and how it should be applied. Explanation of the technology, its application in business, benefits, and the essentials of designing a knowledge management program are introduced and explained in further details. Knowledge Management: Technology and Trends   Ã‚  Ã‚  Ã‚  Ã‚  The practice of knowledge management is often confused with information management. So what is knowledge management? And exactly how should it work? B. Begeron (2003) defines knowledge management as â€Å"the ability to selectively capture, archive, and access the best practices of work-related knowledge and decision making from employees and managers for both individual and group behaviors.† Knowledge management is still a relatively new practice in business organi... ...pplications. (Santosus, 2002) Conclusion   Ã‚  Ã‚  Ã‚  Ã‚  Knowledge management, being a relevantly new practice in business organizations, requires a great deal of planning and setting systematic knowledge management program according to the organization’s business goals. Several factors must be applied to building a successful knowledge management program: 1.  Ã‚  Ã‚  Ã‚  Ã‚  Leadership is essential. 2.  Ã‚  Ã‚  Ã‚  Ã‚  Training and reeducating of knowledge workers is the key to increasing the organization’s assets 3.  Ã‚  Ã‚  Ã‚  Ã‚  Business goal must be set and expectations must be managed. 4.  Ã‚  Ã‚  Ã‚  Ã‚  Knowledge management depends on information technology. 5.  Ã‚  Ã‚  Ã‚  Ã‚  Knowledge management is a constantly evolving process. If a knowledge management program is designed and applied accordingly, beneficial results would occur. We can conclude that knowledge management, instead of being applied as a technology based concept, it should be applied as a daily business practice of sharing information among employees and departments in order to properly import knowledge in to use when it is needed

Compare or contrast two colleges Essay

I have attended to two different colleges in the United States and the fact is that they are quite different in some points. After graduating Quincy High School, I enrolled in an English as Second Language program in the Suffolk University to get accepted to the school. One year later, I transferred to Quincy College. According to my experience, I recognize the differences between a university and a community college in terms of their campus size, tuitions and fees, and their students’ activities. The first difference between a university and a community college is size. A university has a larger campus and more buildings. In contrast, a community college is smaller and has fewer classrooms. For instance, Quincy College only has two main buildings facilitated for teachings and learning while Suffolk University categorizes each major in one large building such as school of law and school of business. Moreover, the university also has more spaces for library, cafeteria, gymnasium, and stadium to serve an enormous student body. On the other hand, the community college has limited spaces to expand its facilities. In general, the university has to provide services for more students than the community college so that its campus should be larger. Secondly, the tuitions and fees of a four-year university are more expensive than a community college. Even though the financial aid can cover some of the tuitions and fees, they are sometimes still too much to afford for some students. For example, I needed to pay the remaining after receiving financial aid by myself. When I was at Suffolk University, I had owed direct loans to the federal government and some private loans. Conversely, my tuitions and fees at Quincy College are fully covered by my financial aid. That saves me a lot and I don’t have to borrow some extra money to finance my college. In addition, after paying off my tuitions and fees, I still have some money for books and stationeries. It can be seen that the community college is much affordable than a university. Thirdly, students’ activities more vary at the university than the community college. Students at the university have more choices for clubs and school activities. A university’s sport team, for example, is established to attract students with sport talents and to compete with other university’s sport team. On the other hand, the community college only offers few of clubs and it does not have a sport league for student to join. With more choices of clubs and extra curriculum activities, the university students have more opportunities to develop their talents and socialize with other students. The community college students, however, do not have many chances and conditions to attend more extra curriculum after school. Students studying at the university would have more options and opportunities to enrich their social life as well as their talents. In conclusion, studying at the community college is more affordable for those who have limited educational budget, but still want to experience an academic college environment. In contrast, despite being costly, the university will satisfy students who like to maximize their capacities with its fully equipped campus and variety of activities. Choosing to study at the community college or the university significantly depends on an individual’s financial conditions, abilities and future plans.

Food and Beverage Essay

Food and Beverage Service is the service of Food made in the Kitchen and Drinks prepared in the Bar to the Customers (Guest) at the Food & Beverage premises, which can be: Restaurants, Bars, Hotels, Airlines, Cruise Ships, Trains, Companies, Schools, Colleges, Hospitals, Prisons, Takeaway etc Food & Beverage Outlets are divided in to the following categories: Restaurants: Restaurants are places where Food & Drink is served. There are various types of Restaurants: All Day Dining Restaurants: They are sometimes called as Coffee Shops or Cafe in Hotels. They are usually big in size with many Covers (seats), compared to other Restaurants in the same Hotel. The main reason why they are called All Day Dining Restaurant is because of their hours of operation, as they are open for Breakfast in the Morning to Lunch in the afternoon to Dinner in the Evening. Fine Dining Restaurants: Fine Dining Restaurants are characterized by their elaborate and exclusive menu with special emphasis on the very high quality food they serve. The emphasis being on fresh ingredients and natural flavors or on the type of Cuisine served, or both. Usually the operation of this restaurant revolves around the Head Chef or Chef De Cuisine of this Outlet. Specialty Restaurants: These are Restaurants which usually have a type of National or Regional Character or Cuisine attached to them, for example: Italian Specialty Restaurant, Chinese Specialty Restaurant etc. In some Hotels they do also sometimes have Multi Cuisine Specialty Restaurant, which literally means that Restaurant serves cuisine from more than one country, or the dishes on the Menu at that Restaurant has Food Specialties from many different countries. 2. Lounge: Lounges can be found in different hotels. Their main purpose is to offer Food & Drinks in relaxed surroundings with comfortable and cozy seating in relaxed surroundings. There are many kinds of Lounges ranging from a Lounge in a Lobby, Cocktail Lounge and Cigar Lounge to Executive and Club Lounge in special Floors. 3. Bar: Bar is a place where drinks are served. There is usually a small Snacks Menu too. The service is fast and quick. There are various kinds of Bars ranging from Formal bars to Club Bars, Pubs, Pool Bars, Wine Bars, Cocktail Bars, Beach Bar to Juice Bars and many more. 4. Discotheque/Nightclub: They are outlets where Music and Entertainment takes priority with the Food & Drink. The operation is very fast and the guest numbers are large. Security is an important aspect in these operations. Music and entertainment can range from DJ to live bands playing. 5. Room Service/In Room Dining: Room Service, also known as In Room Dining . It is the service of Food & Drink in Guest Rooms in a Hotel or a Resort. Depending on the size and type of Hotel or Resort its functions vary. 6. Meeting and Conference Rooms: Meeting and Conference rooms together with Ball Rooms come under the Banquets & Conference section. They are a great source of Revenue in Food & Beverage Department usually in Corporate and City Hotels. MICE (Meetings, Incentives, and Conferences & Exhibitions) can alone bring much revenue in some hotels in comparison to other outlets in Hotel. 7. Ball Rooms: These are large Function Rooms which are primarily used for Functions and Weddings. The Staffing ration of Full Time Staff in this section is very less as the Function and Wedding Business can sometimes be seasonal and extra staff is usually filled in by the use of Casual Staff. This Section is the most Dynamic section in Food & Beverage with the Conference Section, which is more physically demanding and creatively oriented. 8. Delicatessen: Delicatessen or Deli traditionally had been a place where fresh meat and other produce were available. Hotels nowadays use this concept of having a Deli on their premises, where guests can buy fresh produce ranging from Freshly Baked Bread, Cold Meat, Fresh Salads, Cakes, Home Made Ice creams and light and healthy drinks. 9. Others: There are many other Food & Beverage outlets ranging from Fast Food Outlets to Food Courts to Snack Bars which are usually stand alone or in a shopping centre. This is just a brief introduction to Food and Beverage. Detailed information on Food and Beverage can be found at Food and Beverage Bible E Book By Santosh Koripella at: www. foodnbeveragebible. com.

Chemistry of Chocolate Essay

Chocolate is made from the cacao bean. According to Rodney Lipson, â€Å"Cacao has been a cultivated crop for at least three thousand years, probably quite a bit more. The people who first utilized Cacao were the inhabitants of what is now Venezuela† (Lipson) This group of people would eventually spread the cacao bean in northwestern South America. Cacao was clearly highly valued by these people and they spread it northward through trade with their neighbors. It was probably the Maya, over 1500 years ago, who brought Cacao to Yucatan in what is now Mexico. The Aztecs who got Cacao from the Maya, used Cacao in a number of ways, one common way was as a bitter spice in food and possibly also as a base for pasta or bread, but the most well-known way that Cacao was as a drink. While the Maya drank Chocolate hot, the Aztecs seem to have often taken it cold. The Aztecs called the drink, and apparently the bean as well, Xocoatl. From this word comes the pan-European word Chocolate. When Europeans first made contact with the Aztec civilization, Cacao was being cultivated and used extensively. The Spanish Conquistadors quickly noticed the benefits of Chocolate and used it to keep their armies marching long distances with little food. From the Aztecs the Spanish took it to Europe. Chocolate was widely used in Catholic countries after 1569 when Pope Pius V declared that Chocolate, the drink, did not break the fast, despite the hearty nutritional aspects of Chocolate† (Lipson). Chocolate continued to be moved from country to country through trade and exploration. Soon chocolate found its way into America, and according to Lipson, â€Å"In 1900 Milton Snavely Hershey, a Mennonite from Pennsylvania, began producing milk-chocolate bars and â€Å"kisses† with great success. He was anti-alcohol and saw Chocolate as a good, profitable alternative. His empire grew even larger during World War I, when Milton Hershey encouraged the US Army to add four Hershey bars to each soldiers daily ration† (Lipson). Because of Hershey, chocolate was now affordable for everyone, and his methods of making chocolate are still used today. Peter’s chocolate tells us that chocolate is made by, â€Å"storing the cacao beans in silos or warehouse. These rooms are well aired, kept at cool temperature and the humidity regularly checked. Before the production stage, the beans are sorted and cleaned. Cocoa does not acquire the richness of its color and the fullness of its flavor until it is roasted. The degree of care given to this operation has considerable influence on the ultimate quality of the end product – either cocoa powder or chocolate. When roasting is complete, the beans are cooled and their thin shells removed by a winnowing machine. The husked and winnowed beans are called â€Å"nibs†. Here’s where the first secrets of the chocolate manufacturer come in. The nibs are blended, combining as many as eight to ten varieties. It is control of these subtle mixtures that maintains a constant quality and brings out the flavor of each particular variety of chocolate. The roasted and winnowed nibs then pass through refining mills and are ground. The heat generated by grinding causes the cocoa butter or fat to melt and form a fine paste or liquid known as chocolate â€Å"liquor. † This goes to large hydraulic presses which remove most of the cocoa butter. The â€Å"cake† which is left may eventually be made into cocoa powder. The cake goes through several processes in which it is crushed, milled and finely sifted. After the cocoa paste, cocoa butter, milk, sugar and additional flavorings have been carefully weighed out in accordance with the recipe, they go into a mixer where rotating, kneading arms thoroughly mix all the ingredients. The result is a homogeneous, paste-like mixture which is already pleasant to taste, but still feels gritty to the palate. The chocolate is put in a conching machine. While in the machine, the chocolate turns over in the conching machine, a controlled amount of air ventilates the mass, allowing the full aroma and flavor to develop. The still-warm conched chocolate is placed in a tempering machine so that it can be slowly and steadily cooled. The tempering prevents separation in the chocolate when it’s filled into bar molds and hardens† (Peter’s). This results in the average chocolate bar.

To Kill a Mockingbird Essay Questions

TO KILL A MOCKINGBIRD Chapters 1-5 _____l. Jema. respected lawyer in town _____2. Simon Finchb. is the main â€Å"character† actor in the plays performed by the children _____3. Boo Radleyc. never brings a lunch to school because his family is too poor _____4. Atticusd. A big sin because they are innocent; known for their sweet song _____5. Jacke. only comes the first day of every school year; whole family lazy _____6. Calpurniaf. Atticus’s brother; he is a doctor _____7. Mrs. Dubose (Doo-bwah)g. Dill’s Aunt _____8. Miss Rachelh. Arthur _____9. Dilli. Sixth grade teacher ____10.Stephanie Crawfordj. Setting of book ____11. Mr. Radleyk. Place where gifts are exchanged ____12. Alexandral. narrator of the story ____13. Young Arthur Radleym. described as â€Å"looking and smelling like a peppermint drop† ____14. Charles Harris Bakern. town gossip ____15. Nathan Radleyo. Scout ____16. For Boo, From Jem & Dillp. nanny, housekeeper, yells at Scout a lot ____17. Sc outq. Atticus’s sister ____18. Maycomb, Alabama in 1933r. arrested with Cunningham gang for locking Mr. Conner in outhouse ____19. Miss Caroline Fishers. compared to a chameleon; makes individual cakes for the kids ____20.Miss Maudiet. Ancestor who settled Finch’s Landing ____21. Jean Louis Finchu. wishes his dad would play tackle football ____22. Walter Cunninghamv. Boo’s older brother ____23. Mr. Cunninghamw. mean neighbor who sits on his/her porch; two doors down ____24. Miss Blountx. owed an â€Å"entailment† to Atticus ____25. Radley’s Oak Treey. A note to Boo, asking him to come out, ice cream as a reward ____26. Burris Ewellz. supposedly stabbed in the thigh by his son ____27. To Kill A Mockingbirdaa. Dill WRITE ANSWERS ON YOUR OWN PAPER FOR THE FOLLOWING: 1.Give a good explanation of what â€Å"entailment† is. Look on page 21, two paragraphs starting with, â€Å"Atticus said professional people†¦Ã¢â‚¬  2. METAPHOR: In reading a good book or story, we are interesting in what happens, but it is equally interesting to observe HOW the story is written. Miss Maudie is called a ‘chameleon. ’ Explain what a chameleon is, then how this applies to her. Look on page 42, the paragraph starting with, â€Å"Miss Maudie hated her house†¦Ã¢â‚¬  3. EVALUATION THROUGH PREDICTION: Think about the two sticks of chewing gum that were put in the knothole of the tree.Write your answer after the question in the space below: 1. Why do you think that the outer wrapper was taken off, and the tinfoil was left on? 2. Why do you think that there were two pieces instead of just one? 3. Why do you think that the person chose to put gum in the knot-hole instead of something else? 4. COMPARISON AND CONTRAST: The Cunninghams and the Ewells represent a JUXTAPOSITION (putting two things side by side) of â€Å"two kinds of poor. † Make lists of how they are similar and how they are different.

Forced induction Research Paper Example | Topics and Well Written Essays - 750 words

Forced induction - Research Paper Example It is worth noting that the gas compressors are two in series. The first one feeds into the engine intake thus making it a forced induction, while the second one is the main compression that each engine usually has. The compressor that feeds into the engine intake increases to a large extent the full compression ratio of the whole system (Bell 33). It is also important to note that the engines that have higher compression tend to have the advantage of maximizing the amount of energy that is extracted per fuel unit. It is for this reason that the engine’s thermal efficiency is increased according to the analysis of the vapor power cycle of the second thermodynamics law. While higher compression engines have the advantage of maximizing the useful energy quantity, not all the engines are higher compression (Rathakrishnan 54). This is because for any particular octane, the fuel will detonate prematurely at a higher than expected ratio of compression. Although naturally a high comp ression on aspirated engine can reach the threshold f detonation quite easily, a force induction engine can as well have a relatively higher full compression necessarily without detonation. This can be attributed to the fact after the first compression stage the air charge can be cooled using intercooler. Engineers note that one of the key concerns of in internal combustion is the quantity of nitrogen/oxygen compounds that are produced by the engine. Since it is a primary concern, this quantity is regulated by the government at various inspection stations (Nag 29). Mainly, there are two main types of forced induction compressors: superchargers and turbochargers. Supercharges are all directly powered by engine rotation although they can be found as different and distinct compressors types. It should be noted that superchargers do not have lag time of building pressure since the compressor is proportionally spinning to the speed of the engine

Emotional intelligence (EI) Essay Example | Topics and Well Written Essays - 1000 words

Emotional intelligence (EI) - Essay Example Comprehending the differences between the two types of leaders is important for all the candidates of leadership and managerial positions. This paper will compare and contrast the transformational and the transactional leader, and explore the leader who connects with his followers more effectively. Discussion Contrast between transactional and transformation leaders The transactional leader is more concerned about maintaining the normal flow of work operations at the work place. On the other hand, the transformational leader extends his roles beyond those of managing the daily operations of the organization, to the levels of crafting the strategies of taking his team, department or company to the next level of success and performance (Hargis, Wyatt & Piotrowski, 2011). This difference is evident from the managerial outlook of the two leaders, because the transactional leader is often emphasizing the disciplinary structure determined by power to push for the completion of the tasks or the job roles available at the organization. The transformational leader is different from the transactional leader, through their managerial outlook, because they offer attention to the grouping of different employees, appealing to the personal zeal to perform and attending to the individual issues that can increase or affect performance (Kotlyar & Karakowsky, 2007). The second difference between the transactional and the transformational leader is that the transactional leader will often use a range of incentives to motivate the improvement of performance from his employees, but will often not pay attention to personal differences or preferences. On the other hand, the transformational leader will boost the performance of his employees through collaborating with employees, building strategic teams, motivating the workers and through appealing to the differences of different workers. Thirdly, the transactional leader equates giving more rewards to the increment of performance. In the case of the transformational leader, performance is boosted through the combination of incentives and setting higher goals for their subordinates, which pushes them to better performance (Hackman & Johnson, 2009). Fourthly, the transformational leader does not envision making his organization a market leader, but a transformational leader will offer his employees opportunities for professional and personal development so that they can push the organization to the level of a market leader. The similarities between transactional and transformational leaders The similarities between the transactional and the transformational leader are that both types of leaders manage to maintain the flow of operations and the completion of job tasks at their organizations. Through ensuring that the daily operations of an organization are met, the transactional leader keeps the organization afloat, while the transformational leader explores newer ways of improving performance. The second similarit y between transactional and transformational leaders is that they use incentives to motivate their employees so that they can perform better. Through the motivation of the subordinates, these two types of leaders are able to cultivate higher performance and to push the organization to higher levels of success, irrespective of the fact that their vision about the future of the organization is not